For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:77555755+77555864 110bp TTGGAGCTGTTTCCTGATGA CTTGCTTTGGCCTGATAGAGA
Mutant= 129 bp
Wild Type = 110 bp
Sequence
Wt Sequence:ACTGCTGGACTGTCTCTGTAGCCCCTTAGTTGTTTTTATTTATTTGCTTATTTTTGCTGTTACCatgagccaaacccaggaccttaagcatcctaggaagtcctcattcacgtttgttgaacagtacttactaaaggttaccagttggaggccatcattcatttcaggctcagttccacttgctggagtcttcagctagagttgcgtattcctcattcttttttactaatttgtacttttttcttgtttataaaggaaacttttcagtatacacttttcaagtgggctgaagagcttcatgcactgagccgaatacaagacttacttggttgctatgagcaggccttggagctgtttcctgatgatgaagtgatttgcaacagtatgggagagcacctcttcaggtttgtcatgacctcATGAGTATAGGATTATCTCTATCAGGCCAAAGCAAGGATAAATCATGCATTAACTTACTTGGTTTGGTTTTGAGATAGAGTCTTACCACCAGCTCAGTCCAGTCTGGAACTTGTAGGCTTACATCTTGTTTTAG
Deleted Sequence: atgagccaaacccaggaccttaagcatcctaggaagtcctcattcacgtttgttgaacagtacttactaaaggttaccagttggaggccatcattcatttcaggctcagttccacttgctggagtcttcagctagagttgcgtattcctcattcttttttactaatttgtacttttttcttgtttataaaggaaacttttcagtatacacttttcaagtgggctgaagagcttcatgcactgagccgaatacaagacttacttggttgctatgagcaggccttggagctgtttcctgatgatgaagtgatttgcaacagtatgggagagcacctcttcaggtttgtcatgacctc
355 bp deletion beginning at Chromosome 8 positive strand position 77,555,474 bp and ending after 77,555,828 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37473 | TTG GAG CTG TTT CCT GAT GA | Wild type Forward | A | |||
| 37474 | CTT GCT TTG GCC TGA TAG AGA | Common | A | |||
| 37475 | ACT GAA CAC CAA GAG CAG CA | Mutant Forward | A | |||
| 37476 | Fluorophore-1 | TGC AAC AGT ATG GGA GAG CA | Quencher-1 | WT Probe | ||
| 37477 | Fluorophore-2 | CTC TTA ACT GCT GGA CTG TCT CTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37473 | 0.40 uM |
| 37474 | 0.40 uM |
| 37475 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.