For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:39894595-39894685 91bp TAGCGTGCTGGCATCCACT TCAGGTGGCCAACACTCAC
Mutant= 103 bp
Wild Type = 91 bp
Sequence
Wt Sequence: AAAGGTTATGACTAGAAGGCCACTGGGGAGTCTGTGGCTTTACTGCTGATAATGTGCATGTTTTCTTAGTTCCACTGTGGTAGACTGTCATCTCCCTCCtgtggttttgttacagtgggaaagctactttttggtcagtgttccagcgatagtaagaggctctcttgcttttaactatagggactaagtgttgctatcctggggcccacctttccagacttggcgaagaacgtgaacagaaacatcagcagcctgtctctgattttcgtgggccgggcctcaggatatttatgtggctctatgattggaggagtcctgtttggctgtataaatcattttttacttttgggtaagtaaacaccgctcttctttgtttctgtcaacaaatttacaactcagctctaaatggggaagatggtggatacctgagccaggtagcgtgctggcatccactgtgggagctgggaagtctggactgattccctggGAACTCGATGGGCCCTGGGTGTGAGTGTTGGCCACCTGAGCAATGCTGACTTTACTGTGATATAGGCTCCACTCCAGGCACAGGCACTGGCTGACCCTGAAGCTCTGCTTATCTGGGGTAGGGGCGGGGCTTCTGGGGCCACGGGGGAGGAGGA
Deleted Sequence: tgtggttttgttacagtgggaaagctactttttggtcagtgttccagcgatagtaagaggctctcttgcttttaactatagggactaagtgttgctatcctggggcccacctttccagacttggcgaagaacgtgaacagaaacatcagcagcctgtctctgattttcgtgggccgggcctcaggatatttatgtggctctatgattggaggagtcctgtttggctgtataaatcattttttacttttgggtaagtaaacaccgctcttctttgtttctgtcaacaaatttacaactcagctctaaatggggaagatggtggatacctgagccaggtagcgtgctggcatccactgtgggagctgggaagtctggactgattccctgg
388 bp deletion beginning at Chromosome 10 negative strand position 39,895,021 bp and ending after 39,894,634 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37468 | TAG CGT GCT GGC ATC CAC T | Wild type Forward | A | |||
| 37469 | TCA GGT GGC CAA CAC TCA C | Common | A | |||
| 37470 | GGC TTT ACT GCT GAT AAT GTG C | Mutant Forward | A | |||
| 37471 | Fluorophore-1 | AGC TGG GAA GTC TGG ACT GAT | Quencher-1 | WT Probe | ||
| 37472 | Fluorophore-2 | TGG TAG ACT GTC ATC TCC CTC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37468 | 0.40 uM |
| 37469 | 0.40 uM |
| 37470 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.