For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:20265407-20265506 100bp TCTGCATACTACCTCCTTAGGC TCCGAGGTTCTGGCTAAGAC
Mutant= 101 bp
Wild Type = 100 bp
Sequence
WT Region: CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGTGTGTGTGTGTGTGTGCGTGATATTTTCCTAGCTATCAAGAGCATCTGCATACTACCTCCTTAGGCCCTGGCTTCCcactggctcattagagcacacacttcagtcaaccgctggccacttagtgtcttagccagaacctcggatccttcatgtccatttctgtgaacaggaatgatgctatctaagagacaggaaagcatcctcctgagagcttggtgacaggctgcactcagtaactgctgagcctgctgtccgtgcttcttccacaggtcatcctggaagcctgggtgaagggtgtgaaccccaaaggcaactccaccaatcccagcaactgggacttcgggagcagcttcttctttgcaggcacagtggtcaccaccataggtaagtgggagaggagtgaggcctcccttggccctgctgagcttggggtccattctaaatgccactgctggtctgggaatatgctttatccCGGAGGTGACAGACAGGGCACAGGTTGGGAAGTGGGTAGGTTGGCTGCAGCTGTAGTTGCCTGGACTCACTTCTCTGGGTCACACTGAAGGGTTAGAAAGAGCTATTCCTCAGTACA
Deleted Sequence cactggctcattagagcacacacttcagtcaaccgctggccacttagtgtcttagccagaacctcggatccttcatgtccatttctgtgaacaggaatgatgctatctaagagacaggaaagcatcctcctgagagcttggtgacaggctgcactcagtaactgctgagcctgctgtccgtgcttcttccacaggtcatcctggaagcctgggtgaagggtgtgaaccccaaaggcaactccaccaatcccagcaactgggacttcgggagcagcttcttctttgcaggcacagtggtcaccaccataggtaagtgggagaggagtgaggcctcccttggccctgctgagcttggggtccattctaaatgccactgctggtctgggaatatgctttatcc
400 bp deletion beginning at Chromosome 14 positive strand position 20,265,075 bp and ending after 20,265,474 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37333 | TCT GCA TAC TAC CTC CTT AGG C | Common | A | |||
| 37334 | TCC GAG GTT CTG GCT AAG AC | Wild type Reverse | A | |||
| 37335 | TGA GTC CAG GCA ACT ACA GC | Mutant Reverse | A | |||
| 37336 | Fluorophore-1 | CAG TCA ACC GCT GGC C | Quencher-1 | WT Probe | ||
| 37337 | Fluorophore-2 | AGA CAG GGC ACA GGT TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37333 | 0.40 uM |
| 37334 | 0.40 uM |
| 37335 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.