For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 142 bp
Wild Type = 148 bp
>chr19:6939718-6939865 148bp AGGTGTGGCCATCTGAGTTC CAGTGAAGCACCCACGAAG
Sequence
Wt Sequence (deletion in lower case)
CATCTGCAGAAAGAGATGAGCAGAGTTTAGGTGTGGCCATCTGAGTTCTAACTGACCCTGGGGTCTCCTGAGgagtcagggttgctggtgagggccgaggggatccgtggtctggggctgactttgctgtgggctgcaggctggctgtccgaggggccttcgtgggtgcttcactgctctttttgctggtgaatgtactgtgtgcagtgctgtctcgccagcgccaggcacagccctgggtccttctgctggtacgtgtcctggtgagcgactctctcttcgtcatctgtgccctctcgcttgctgcctgcctctgccttgtggcccgtcgagccccttccaccagcatctacttagaggccaaggtagagccaccaaccttgatgtagcacccttgggggtccttggacagagttctttaggatgtaaaggaatataggagccctcctctccatgaagatcctctattgtcatctctgccaggggaccagcgtgtgtcaggcagctgctatagggggtgccatggtccttctctatgccagccgggcctgttacaacctggcagctctggccttggcccctcggagccggctagatgccttcgattacgactggtacaacgtatctgaccaggtaggcattggtcctgtttgtcccttctttggtaactataataactagcctccagctggccagggccctgccagcagcctctgtggtggcagaatgtcctcagcccctgcttttccccaggcagatctggtgaatgacctagggaacaaaggctacctggtgtttggtctcatcctcttcgtttgggaactgctgcccaccacattgctggtgggcttcttccgggtacaccggcccccacaggatctggtagggacccccccccaaccacctcttggtcCAGTATAGAGGGCTGGACCCTGGGAATTCTGGTCTGGGGTCCTGGGACAGTTACGGCAGCAGAAGAAAATATCCATAGTACCGACTTCTTTCCCCATACCTTAC
841 bp deletion beginning at Chromosome 19 negative strand position 6,939,821 bp and ending after 6,938,981 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37266 | AGG TGT GGC CAT CTG AGT TC | Common | A | |||
| 37267 | TAT GGG GAA AGA AGT CGG TAC T | Mutant Reverse | A | |||
| 37268 | CAG TGA AGC ACC CAC GAA G | Wild type Reverse | A | |||
| 37269 | Fluorophore-1 | TCC TGG GAC AGT TAC GGC | Quencher-1 | MUT Probe | ||
| 37270 | Fluorophore-2 | CTG ACT TTG CTG TGG GCT G | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37266 | 0.40 uM |
| 37267 | 0.40 uM |
| 37268 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.