For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 139 bp
Wild Type = 141 bp
>chr12:55841784+55841924 141bp GCCAGGAGGCTTCAGTTATTG GTGCAGCGATGGAAACACT
Sequence
WT sequence (deletion in lower case, ^G^ is an insertion):
tggatgtccagtttcatattacaactttttttttttctgtctggactaacatcagaattttttgaaacagttttatcttttctgtttgtttttattttttgagatagggtttcatgtatcccaggctggcctcaaacatgctaagtggcgaatagtcatagctagtcttagactcctaatcctgcctgtgcctcccaagcgctggaatctcaagtgtgtgcctccaggcctgccctgaagttttatctttgatatttccttttttttttttaacagaaatggatgatgaagattgtgaaaggagaaggatggagtgtttagatgagatgtccaacctggagaagcagtttacagacctcaaagatcagtaagtactaaccagatggccctcgtcactgaatctcagtggcatcagttttaccagcacaggagcaattacagcgtttctgctgtgtttccttttgtgttttatgggaactggctgatctggccaggaggcttcagttattgtttacccgctagagacctcattagctcaacagagttttgaggccagtgaggtTTTGGGGGTGGATGGAGTAGGTGACTTGCATGGGCACGCTGCTGATTCGAGTGTTTCCATCGCTGCACACTGCTTCTGTGTGTGCTGTTCATTCCCTTGTTA
562 bp deletion beginning at Chromosome 12 positive strand position 55,841,295 bp and ending after 55,841,856 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000654815 (exon 2) and 471 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) insertion at the deletion site
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37223 | GAC ATT ACG TTA ATT CTA TGG TGG T | Mutant Forward | A | |||
| 37224 | GTG CAG CGA TGG AAA CAC T | Common | A | |||
| 37225 | GCC AGG AGG CTT CAG TTA TTG | Wild type Forward | A | |||
| 37226 | Fluorophore-1 | CTG GAC CTG TTT GGG GGT | Quencher-1 | MUT Probe | ||
| 37227 | Fluorophore-2 | CCG CTA GAG ACC TCA TTA GCT C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37223 | 0.40 uM |
| 37224 | 0.40 uM |
| 37225 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.