For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 140 bp
Wild Type = 161 bp
>chr7:65697512+65697672 161bp CCCAGTCCATAGCCTTTTTC TCAGTTACAAGATGGCAGCTC
Sequence
Wt Sequence: gaccaggctggcttcaaactcagagctccacccgcccctgcctcccaggggttaggcgtgcaccagcatgcccagtccatagcctttttcctttaggtaaactgtatagattttttttcccctcgatgctacatacgagccttcttCctatatgaactgctaggccctaaatacagtgtttcagaaatctgggtctgttgatatcataacgagctgccatcttgtaactgattgagtttgtgctttggtcctagGATCAAGACCTCAAACCCCAGAGGAACTTCGTCATC
Mutant Sequence: aggggttaggcgtgcaccagcatgcccagtccatagcctttttcctttaggtaaactgtatagattttttttcccctcgatgctacatacgagccttcttCCtgatggccctggacccacctggggcatcgcttgctttcctccccttgctctggcctcacagaggtgacttgccatctggattttattctctgcttcctttcaggaagatacctgcccctt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35376 | CCC AGT CCA TAG CCT TTT TC | Common | A | |||
| 35377 | TCT GTG AGG CCA GAG CAA G | Mutant Reverse | A | |||
| 35378 | TCA GTT ACA AGA TGG CAG CTC | Wild type Reverse | A | |||
| 35380 | Fluorophore-1 | AGT GTT TCA GAA ATC TGG GTC TGT | Quencher-1 | WT Probe | ||
| 37143 | Fluorophore-2 | CCT TCT TCC TGA TGG CCC TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35376 | 0.40 uM |
| 35377 | 0.40 uM |
| 35378 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.