For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 112 bp
Wild Type = 116 bp
>chr9:80435486-80435601 116bp TTAACACAGGCTAGCACACTTG AGTTAGCCATGCAAAATGGA
Sequence
Wt Sequence (deleted region in lower case)
CCAGTGTAGACAGACAATCCCTTCTTGATGTTCTCTGGTTCTGCTTTGTGTCCATTGGCAGTTAACACAGGCTAGCACACTTGTAAATTAGTGTGTGAACATAagctggaaaacactttctgtattgtgacactgtgtgctttagggaacagggttttccattttgcatggctaactttaactgttttgtgttacagtatgtcaagaagtcgtgtgggaagcatatcgtatctttctggaccgaattcctgacacagaggaatatcaagactgggtcagcctctgccagaaagaaaccttctgcctctttgacattgggaaaaacttcagcaactcccaggagcacctagatcttcttcagcaggtaaaccttttcaatatcctaggagcagcagggccccagcccctgccccttTGAAATGGTTACTAAGGCATAAGAGTTACTTGACAAAATACTTAGAGATAGCTGATAAGACAGACAGGAATTTTATTCCTGCAAAATAATATTGCACAGGCAGGTTGACGTGTAGTTGAAGGCAGAAAGAATGAAAATAGACTTTAGCTC
312 bp deletion beginning at Chromosome 9 negative strand position 80,435,559 bp and ending after 80,435,248 bp (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37133 | TTA ACA CAG GCT AGC ACA CTT G | Common | A | |||
| 37134 | TTC CTG TCT GTC TTA TCA GCT ATC TC | Mutant Reverse | A | |||
| 37135 | AGT TAG CCA TGC AAA ATG GA | Wild type Reverse | A | |||
| 37136 | Fluorophore-1 | TGG TTA CTA AGG CAT AAG AGT TAC TTG A | Quencher-1 | MUT Probe | ||
| 37137 | Fluorophore-2 | ACA CTG TGT GCT TTA GGG AAC A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37133 | 0.40 uM |
| 37134 | 0.40 uM |
| 37135 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.