For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 138 bp
Wild Type = 130 bp
>chr17:23733540+23733669 130bp AAAGCCTGGACACAGCAGAG ACAACGGTGCATCAGAGACC
Sequence
Wt Sequence: AAAGCCTGGACACAGCAGAGaCACTGTCCGTGGTTTGGGGGACTACCATTTCCTCTTAGCACTGGACCCTGGTCATAGCACATAGGTCTACCCCACCTCCTCTGTTGCTGGGTCTCTGATGCACCGTTGT
Mutant Sequence: AAAGCCTGGACACAGCAGAGacATCTGGGACTACAGCCAGACCCAGGGTTTTGAGACCATACTGGCTACTACTACCCTGCCTCAGTGTATTCTGTTCATCTCTACAGAATGATGATGCCAACCCTAGTAACCATGGAA
1036 bp deletion beginning at Chromosome 17 positive strand position 23,733,561 bp and ending after 23,734,596 bp (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36971 | AAA GCC TGG ACA CAG CAG AG | Common | A | |||
| 36972 | TTC CAT GGT TAC TAG GGT TGG | Mutant Reverse | A | |||
| 36973 | ACA ACG GTG CAT CAG AGA CC | Wild type Reverse | A | |||
| 36974 | Fluorophore-1 | AGA CCC AGG GTT TTG AGA CC | Quencher-1 | MUT Probe | ||
| 36975 | Fluorophore-2 | CTT AGC ACT GGA CCC TGG TC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36971 | 0.40 uM |
| 36972 | 0.40 uM |
| 36973 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.