For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 144 bp
>chr19:59042027-59042170 144bp GGTTTGTAGTTTGCATGTGTGC CCCCATGACCAAGAAGAATGT
Sequence
Wt Sequence:
Mutant Sequence:
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36741 | GGT TTG TAG TTT GCA TGT GTG C | Common | A | |||
| 36742 | TGC TTA CAG AAT CAT ATT CCA GGA C | Mutant Reverse | A | |||
| 36743 | CCC CAT GAC CAA GAA GAA TGT | Wild type Reverse | A | |||
| 36744 | Fluorophore-1 | ATG GGG AGG TGT AAG GTT CC | Quencher-1 | MUT Probe | ||
| 36745 | Fluorophore-2 | AGC CAA AGG TCT AGC TGT AGG A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36741 | 0.40 uM |
| 36742 | 0.40 uM |
| 36743 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.