Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 118 bp
Wild Type = 127 bp
>chr5:30199307-30199433 127bp CTCTCGTGGCTCCTGTCTCT GGCTCAAGGTACAGGGATAACA
Wt Sequence:
Mutant Sequence:
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36727 | CTC TCG TGG CTC CTG TCT CT | Common | A | |||
| 36728 | CAC CAC CAC CAC CAC ATA GA | Mutant Reverse | A | |||
| 36729 | GGC TCA AGG TAC AGG GAT AAC A | Wild type Reverse | A | |||
| 36730 | Fluorophore-1 | AGT GGA TCC TCC AGG GAC A | Quencher-1 | MUT Probe | ||
| 36733 | Fluorophore-2 | CTG ACC TCT GAG TGG CTT GTC | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36727 | 0.40 uM |
| 36728 | 0.40 uM |
| 36729 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.