Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 134 bp
Wild Type = 139 bp
>chr10:93216463+93216601 139bp GGATCTCAATGGAGGTAACCA GGCAAAGAAACAGCTCTTGTG
Wt Sequence:
Mutant Sequence:
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36717 | TGT CAG GTT GAC CCA AAA CA | Mutant Forward | A | |||
| 36718 | GGC AAA GAA ACA GCT CTT GTG | Common | A | |||
| 36719 | GGA TCT CAA TGG AGG TAA CCA | Wild type Forward | A | |||
| 36720 | Fluorophore-1 | AGC ACA GCT GGC CTG AGA | Quencher-1 | MUT Probe | ||
| 36721 | Fluorophore-2 | AGT GGA AAC GCA ACC ATT GT | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36717 | 0.40 uM |
| 36718 | 0.40 uM |
| 36719 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.