Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:73318403+73318497 95bp CACTTTTGGGCATGGACCT GAAAATGGATGTGGGTTGGT
Mutant= 90 bp
Wild Type = 95 bp
Wt Sequence: CACTTTTGGGCATGGACCTTGTCAGgtaacagttgtgctgctttcccactgtagatgatgtgggaaatGGtaaataccaacccacatccattttc
Mutant Sequence: agtgctcttaaccactgaaccatctctccagcccctgcatgagttttattattgaaaatttaaTGtaaataccaacccacatccattttc
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36697 | CAC TTT TGG GCA TGG ACC T | Wild type Forward | A | |||
| 36698 | GAA AAT GGA TGT GGG TTG GT | Common | A | |||
| 36699 | AGT GCT CTT AAC CAC TGA ACC AT | Mutant Forward | A | |||
| 36700 | Fluorophore-1 | CAG GTA ACA GTT GTG CTG CTT T | Quencher-1 | WT Probe | ||
| 36701 | Fluorophore-2 | CCA GCC CCT GCA TGA GT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36697 | 0.40 uM |
| 36698 | 0.40 uM |
| 36699 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.