For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:70972850+70972947 98bp TCATGAGACATGTGGCCAGT GGTTTAATCCCTGAGCAAGACA
Mutant= 94 bp
Wild Type = 98 bp
Sequence
Wt Sequence: tcatgagacatgtggccagtTAatacttcatgtggagtgggaaaacaccactttctctctgctctgtctctgtttatgtcttgctcagggattaaacc
Mutant Sequence: tcatgagacatgtggccagtTCTGCTCAGAGAGgcagagtcttccctacctatgagaccgaccTCAGgcctggctcaggattaggtttgctgtt
215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36692 | TCA TGA GAC ATG TGG CCA GT | Common | A | |||
| 36693 | GGT TTA ATC CCT GAG CAA GAC A | Wild type Reverse | A | |||
| 36694 | AAC AGC AAA CCT AAT CCT GAG C | Mutant Reverse | A | |||
| 36695 | Fluorophore-1 | ATG TGG AGT GGG AAA ACA CC | Quencher-1 | WT Probe | ||
| 36696 | Fluorophore-2 | AGT CTT CCC TAC CTA TGA GAC CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36692 | 0.40 uM |
| 36693 | 0.40 uM |
| 36694 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.