For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:99877844+99877947 104bp CCTCTCCTGGTGTACCATTC ATTTTCCTGAGCCAGACTGC
Mutant= 139 bp
Wild Type = 104 bp
Sequence
Wt Sequence: cctctcctggtgtaccattcattttgactcAGagtgtgacctcactgattgatggctacgtttcactaggtcacttggggctgggcagtctggctcaggaaaat
Mutant Sequence: cctctcctggtgtaccattcattttgactcAAAGGGGGAaggtcactgagaatccaagaattagtcaccatttttagactttcctagcagtaaaaatctactagagtaaaatttttattgtgggattttacttggctagg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36661 | CCT CTC CTG GTG TAC CAT TC | Common | A | |||
| 36662 | ATT TTC CTG AGC CAG ACT GC | Wild type Reverse | A | |||
| 36663 | CCT AGC CAA GTA AAA TCC CAC A | Mutant Reverse | A | |||
| 36664 | Fluorophore-1 | TGT GAC CTC ACT GAT TGA TGG | Quencher-1 | WT Probe | ||
| 36665 | Fluorophore-2 | AGG TCA CTG AGA ATC CAA GAA TTA GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36661 | 0.40 uM |
| 36662 | 0.40 uM |
| 36663 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.