For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 106 bp
Wild Type = 108 bp
>chr13:38039891+38039998 108bp GCAAAAGCAAAGCCAACAC CCCAATCTGCTCCGTCTTCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36620 | GCA AAA GCA AAG CCA ACA C | Common | A | |||
| 36621 | CCA GTG GCT GGC TAA ACA GT | Mutant Reverse | A | |||
| 36622 | CCC AAT CTG CTC CGT CTT CT | Wild type Reverse | A | |||
| 36623 | Fluorophore-1 | CAG TCC TGA CAT CAC TGA GCC | Quencher-1 | MUT Probe | ||
| 36624 | Fluorophore-2 | TGC AGA TGA GGA GAC AGA GAA CT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36620 | 0.40 uM |
| 36621 | 0.40 uM |
| 36622 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.