For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 114 bp
Wild Type = 145 bp
>chr8:26160596+26160740 145bp TGCACTGTCAAGTGTCTTCG AAGATAAAGAAAAGCCCCACAC
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35946 | AAG ATA AAG AAA AGC CCC ACA C | Wild type Reverse | A | |||
35948 | Fluorophore-1 | AGA GTC TCC TTA GGA TGG GGT AA | Quencher-1 | WT Probe | ||
36603 | TGC ACT GTC AAG TGT CTT CG | Common | A | |||
36604 | AAC CAC TAA GCC CCA ACA GT | Mutant Reverse | A | |||
36605 | Fluorophore-2 | AGC TTC CTG AGA AAG GAT AAC AAA A | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35946 | 0.40 uM |
36603 | 0.40 uM |
36604 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |