For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:128016101+128016258 158bp GGCGCAGTATATTCTCACAGAG AAAGGTGCGTTTCATCAACA
Mutant= 149 bp
Wild Type = 158 bp
Sequence
Wt Sequence: GGCGCAGTATATTCTCACAGAgtaaggaatcttttttttcttttgtattttgtttgtatcttttttgtgtgtttattttataagccagagtgagttcttgcccccaagttttgaaGGtaatgttttagagtgtattattgttgatgaaacgcaccttt
Mutant Sequence: aaccctgtctcgaaaaaccaaaaaaaaaaaaaaaacaaaaaaaaaacgaacatatgtcttcccattagttaaggttttagttaaggttacattatgccctAGtaatgttttagagtgtattattgttgatgaaacgcaccttt
278 bp deletion beginning at Chromosome 10 negative strand position 128,016,216 bp.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21666 | AAC CCT GTC TCG AAA AAC CA | Mutant Forward | A | |||
| 36408 | GGC GCA GTA TAT TCT CAC AGA G | Wild type Forward | A | |||
| 36409 | AAA GGT GCG TTT CAT CAA CA | Common | A | |||
| 36411 | Fluorophore-1 | AGT GAG TTC TTG CCC CCA AG | Quencher-1 | WT Probe | ||
| 38421 | Fluorophore-2 | AGG TTT TAG TTA AGG TTA CAT TAT GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 21666 | 0.40 uM |
| 36408 | 0.40 uM |
| 36409 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.