For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:10532545+10532671 127bp TGATGAACAACCAGCTCACA TCAATCAGTGCAGGCTTTTCT
Mutant= 118 bp
Wild Type = 127 bp
Sequence
Wt Sequence: tgatgaacaaccagctcacatgtcagtcaaaattaaaataaattttagtcttaatccccAAacataggggttgtgggattagatgtgtttaatgtgtaggacaataagaaaagcctgcactgattga
Mutant Sequence: tgatgaacaaccagctcacatgtcagtcaaaattaaaataaattttagtcttaatccccATagtgggtgggcctaagaatgagatgtgtgtaaagaggacagtgctgggagtcaggtt
970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36402 | TGA TGA ACA ACC AGC TCA CA | Common | A | |||
| 36403 | TCA ATC AGT GCA GGC TTT TCT | Wild type Reverse | A | |||
| 36404 | AAC CTG ACT CCC AGC ACT GT | Mutant Reverse | A | |||
| 36405 | Fluorophore-1 | CAT AGG GGT TGT GGG ATT AGA TG | Quencher-1 | WT Probe | ||
| 36406 | Fluorophore-2 | TGG GCC TAA GAA TGA GAT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36402 | 0.40 uM |
| 36403 | 0.40 uM |
| 36404 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.