Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr18:67967120+67967227 108bp TTGCTTGGTATCTGTCTTCTGC CATGGTTCCCAAGACAAAGG
Mutant= 116 bp
Wild Type = 108 bp
Wt Sequence: ttgcttggtatctgtcttctgcttttatcctgtggtaagcagtgttttggtttgtcacGGgcttttgtagagctttcttgatgaatttcctttgtcttgggaaccatg
Mutant Sequence: catgagaggcagggtgatggtgattattctctttggagctggggaactctgtgccacagaagcccaCGgcttttgtagagctttcttgatgaatttcctttgtcttgggaaccatg
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36160 | TTG CTT GGT ATC TGT CTT CTG C | Wild type Forward | A | |||
| 36161 | CAT GGT TCC CAA GAC AAA GG | Common | A | |||
| 36162 | CAT GAG AGG CAG GGT GAT G | Mutant Forward | A | |||
| 36163 | Fluorophore-1 | CCT GTG GTA AGC AGT GTT TTG G | Quencher-1 | WT Probe | ||
| 36164 | Fluorophore-2 | CTC TTT GGA GCT GGG GAA C | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36160 | 0.40 uM |
| 36161 | 0.40 uM |
| 36162 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.