For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:83017380+83017469 90bp GCTGGATAGCTAGAGCTTTGGT CATGGTGAGTACGCGTTACAAG
Mutant= 96 bp
Wild Type = 90 bp
Sequence
Wt Sequence:gctggatagctagagctttggttgtgttacagcatccagtctaaatatccCGacactgacaaagcagtcttgtaacgcgtactcaccatg
Mutant Sequence: gctggatagctagagctttggttgtgttacagcatccagtctaaatatccCGaggttgtgttccttttttaaggtgtgtgcttacagataattgag
258 bp deletion beginning at Chromosome 10 positive strand position 83,554,686 bp GACACTGACAAAGCAGTCTT, and ending after AGGATGTTCAGACACTGCTG at 83,554,943 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35931 | GCT GGA TAG CTA GAG CTT TGG T | Common | A | |||
| 35932 | CAT GGT GAG TAC GCG TTA CAA G | Wild type Reverse | A | |||
| 35933 | CTC AAT TAT CTG TAA GCA CAC ACC | Mutant Reverse | A | |||
| 35934 | Fluorophore-1 | AAT ATC CCG AGG TTG TGT TCC | Quencher-1 | MUT Probe | ||
| 35935 | Fluorophore-2 | AAT ATC CCG ACA CTG ACA AAG C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35931 | 0.40 uM |
| 35932 | 0.40 uM |
| 35933 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.