For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:40774103+40774275 173bp ATGGTGTGCATGTGGAAATCT TTACTGTCAAACTAAAATGATTAGCTG
Mutant= 178 bp
Wild Type = 173 bp
Sequence
Wt Sequence: ttgcaggagttggttctctctaccacgTGtgatctggaggttatatgcagggtattagcttggtgacatgtcctttccctgctgagctatttcagtagtcctctgacacgatgggtcagctaatca
Mutant Sequence: ttgcaggagttggttctctctaccacgTAaggtatgaaaaaaaaaagactaaaacttctgtatattatttaaaataaataaaatgtgtcttatttgcaaatagatatttatattaaaatttgtaaacaagcagggtatggtacatgtc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33927 | GAC ATG TAC CAT ACC CTG CTT G | Mutant Reverse | A | |||
| 33928 | Fluorophore-1 | TGA TCT GGA GGT TAT ATG CAG G | Quencher-1 | WT Probe | ||
| 35924 | ATG GTG TGC ATG TGG AAA TCT | Common | A | |||
| 35925 | TTA CTG TCA AAC TAA AAT GAT TAG CTG | Wild type Reverse | A | |||
| 35926 | Fluorophore-2 | ATG TGT CTT ATT TGC AAA TAG ATA TTT AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33927 | 0.40 uM |
| 35924 | 0.40 uM |
| 35925 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.