For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:66709084+66709193 110bp TGACATGTGGATATTTTCATAGTTG TGCTCTGACAAAACAAAGAAGG
Mutant= 99 bp
Wild Type = 110 bp
Sequence
Wt Sequence: tgacatgtggatattttcatagttgtttttgaTCcttcacttctatcctgtgttgcctttcctgccttaaagagtattagaatattttccttctttgttttgtcagagca
Mutant Sequence: tgacatgtggatattttcatagttgtttttgaTGtgtggtgtatgtattgggtgtatgaacgtatgcgtgtggatatgtgtgtgcttgtagaggctaga
466 bp deletion beginning at Chromosome 7 positive strand position 66709117 bp for 197 bases where 3 endogenous bp (GGT) are retained, followed by an additional 269 bp deletion ending at 66709585 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36253 | TCT AGC CTC TAC AAG CAC ACA CA | Mutant Reverse | A | |||
| 36254 | TGA CAT GTG GAT ATT TTC ATA GTT G | Common | A | |||
| 36255 | TGC TCT GAC AAA ACA AAG AAG G | Wild type Reverse | A | |||
| 36256 | Fluorophore-1 | CTA TCC TGT GTT GCC TTT CCT G | Quencher-1 | WT Probe | ||
| 36257 | Fluorophore-2 | TGG TGT ATG TAT TGG GTG TAT GAA C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36253 | 0.40 uM |
| 36254 | 0.40 uM |
| 36255 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.