For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:5852041-5852159 119bp CCAGTGATGATTCTGTTTGTAATGG GACAACCAAAGGGACCATGT
Mutant= 105 bp
Wild Type = 119 bp
Sequence
Wt Sequence: ccagtgatgattctgtttgtaatggagctCAcggtggaagcagcagaggcactctgttccgtccctcgacttcccttctgggcggctgctgcttctgtgacatggtccctttggttgtc
Mutant Sequence: ccagtgatgattctgtttgtaatggagctCCactaaagagaggaaagaaggcagtagaccgtgtccctgccgctccccattgcttcagcacagcagacttagcaa
597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35904 | CCA GTG ATG ATT CTG TTT GTA ATG G | Common | A | |||
| 35905 | GAC AAC CAA AGG GAC CAT GT | Wild type Reverse | A | |||
| 35906 | TTG CTA AGT CTG CTG TGC TGA | Mutant Reverse | A | |||
| 35907 | Fluorophore-1 | CAG AGG CAC TCT GTT CCG TC | Quencher-1 | WT Probe | ||
| 35908 | Fluorophore-2 | AGT AGA CCG TGT CCC TGC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35904 | 0.40 uM |
| 35905 | 0.40 uM |
| 35906 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.