For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:31096283-31096399 117bp TGAGTTTGCGACCATCTCTG GCCGGTTCATTACACAACAG
Mutant= 126 bp
Wild Type = 117 bp
Sequence
Wt Sequence: tgagtttgcgaccatctctggCCtgagaataaacagaggcagaggctgcatttcacagagcacccgtggccgggtttgggttgtaattaattctgagctgttgtgtaatgaaccggc
Mutant Sequence: tgagtttgcgaccatctctggCCtgagagacacaaggactggggtgtggtggctcacacccgtgctcctagcactgggggtgttgggaggaggcagggcgaaaagttttctgcaaattcgatgacc
397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35768 | TGA GTT TGC GAC CAT CTC TG | Common | A | |||
| 35769 | Fluorophore-1 | GCC GGT TCA TTA CAC AAC AG | Quencher-1 | Wild type Reverse | A | |
| 35770 | GGT CAT CGA ATT TGC AGA AAA C | Mutant Reverse | A | |||
| 35771 | Fluorophore-2 | CAG AGG CAG AGG CTG CAT | Quencher-2 | WT Probe | ||
| 35772 | Fluorophore-3 | TGG CTC ACA CCC GTG C | Quencher-3 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35768 | 0.40 uM |
| 35769 | 0.40 uM |
| 35770 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.