For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:30935304-30935453 150bp TTATGTTCTTGAAGTGGAGGGATTC TTATCTGTGAAACCACTGACTGAAGC
Mutant= 156 bp
Wild Type = 150 bp
Sequence
Wt Sequence: ttatgttcttgaagtggagggattcatatttagggatatcccaCAtgggtcatttactgtattatttattttgattattaactttttatttttatggtaatatgtatgaggcttaacaagttttgcttcagtcagtggtttcacagataa
Mutant Sequence: gtgaaatcctaaaccaaaaagtgttacttttgccattatagattctcagTAtgggtcatttactgtattatttattttgattattaactttttatttttatggtaatatgtatgaggcttaacaagttttgcttcagtcagtggtttcacagataa
346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35761 | TTA TGT TCT TGA AGT GGA GGG ATT C | Wild type Forward | A | |||
| 35762 | TTA TCT GTG AAA CCA CTG ACT GAA GC | Common | A | |||
| 35763 | GTG AAA TCC TAA ACC AAA AAG TGT | Mutant Forward | A | |||
| 35764 | Fluorophore-1 | AGG GAT ATC CCA CAT GGG TC | Quencher-1 | WT Probe | ||
| 35765 | Fluorophore-2 | TGC CAT TAT AGA TTC TCA GTA TGG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35761 | 0.40 uM |
| 35762 | 0.40 uM |
| 35763 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.