For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:28268554+28268655 102bp CCAGAGGGTGGATTTTGACA TGGATGAACTTATCGCAACC
Mutant= 91 bp
Wild Type = 102 bp
Sequence
Wt Sequence: CCAGAGGGTGGATTTTGACATTTTAACGTTTACCATAGCCCTGACTGCATCAGAGGTGATCAATCCTCTAATAGAAGaactgggttgcgataagttcatcca
Mutant Sequence: gttcttcccgggtctcagcgagcagcggtgctgaccccgcggtccgacatgtcgcagctgcccgcAAactgggttgcgataagttcatcca
658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35739 | GTT CTT CCC GGG TCT CAG C | Mutant Forward | A | |||
| 35740 | TGG ATG AAC TTA TCG CAA CC | Common | A | |||
| 35741 | CCA GAG GGT GGA TTT TGA CA | Wild type Forward | A | |||
| 35742 | Fluorophore-1 | ACG TTT ACC ATA GCC CTG ACT G | Quencher-1 | WT Probe | ||
| 35743 | Fluorophore-2 | GGT CCG ACA TGT CGC AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35739 | 0.40 uM |
| 35740 | 0.40 uM |
| 35741 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.