For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 137 bp
Wild Type = 148 bp
>chr2:24952437+24952584 148bp GTTGTTGATCAGGATGTGACC TGAGAAGAAGCACAGAGCAGAG
Sequence
Wt Sequence: gttgttgatcaggatgtgacccctGtacttttggggtcctaggagcaggatatcatctgtacttctggcatttttctgagctggatttgaaatatgctgagagttaaaggctttccaacagatgcactctgctctgtgcttcttctca
Mutant Sequence: gttgttgatcaggatgtgacccctGagaaggatccatgggtctcatctcatcaaaatcccactagttgtttaaagtgatatgtacattagtcactcctttgGgtgagtcataggttacatccttagaaacggggtca
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35386 | GTT GTT GAT CAG GAT GTG ACC | Common | A | |||
| 35387 | TGA CCC CGT TTC TAA GGA TG | Mutant Reverse | A | |||
| 35388 | TGA GAA GAA GCA CAG AGC AGA G | Wild type Reverse | A | |||
| 35389 | Fluorophore-1 | ACT CCT TTG GGT GAG TCA TAG GT | Quencher-1 | MUT Probe | ||
| 35390 | Fluorophore-2 | TTT TGG GGT CCT AGG AGC A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35386 | 0.40 uM |
| 35387 | 0.40 uM |
| 35388 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.