Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 113 bp
Wild Type = 103 bp
>chr18:84722065-84722167 103bp GAAAATTATGCGTGCGTATCC TGCTCATCTTCAGCACAGGA
Wt Sequence:gaaaattatgcgtgcgtatcctccttccctttGttatggtaaattccttaaatgcagttatgacattcttctcccacttctaatcctgtgctgaagatgagca
Mutant Sequence:ttgagaattgggaagactcactaaaacattaaaactgtatgGGttatggtaaattccttaaatgcagttatgacattcttctcccacttctaatcctgtgctgaagatgagca
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35337 | TTG AGA ATT GGG AAG ACT CAC T | Mutant Forward | A | |||
| 35338 | TGC TCA TCT TCA GCA CAG GA | Common | A | |||
| 35339 | GAA AAT TAT GCG TGC GTA TCC | Wild type Forward | A | |||
| 35340 | Fluorophore-1 | TGG GTT ATG GTA AAT TCC TTA AAT G | Quencher-1 | MUT Probe | ||
| 35341 | Fluorophore-2 | CTT CCC TTT GTT ATG GTA AAT TCC T | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35337 | 0.40 uM |
| 35338 | 0.40 uM |
| 35339 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.