Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 95 bp
Wild Type = 102 bp
>chr14:56270095+56270196 102bp TGTATCCACTGTGTGAGAGCAC AAAGCCATGGAGTTGTGAGC
Wt Sequence:tgtatccactgtgtgagagcactttatacacaatggtgaactagtggtcctcaggtaccatcctctctcccttttgggCtctgctcacaactccatggcttt
Mutant Sequence:CCACGTGAGATACAGgtcagaaagggagctgaaagaaggaacttaggcttattaataagctacttgaggtACtctgctcacaactccatggcttt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35305 | CCA CGT GAG ATA CAG GTC AGA | Mutant Forward | A | |||
| 35306 | AAA GCC ATG GAG TTG TGA GC | Common | A | |||
| 35307 | TGT ATC CAC TGT GTG AGA GCA C | Wild type Forward | A | |||
| 35308 | Fluorophore-1 | AGC TGA AAG AAG GAA CTT AGG CTT A | Quencher-1 | MUT Probe | ||
| 35309 | Fluorophore-2 | CAG GTA CCA TCC TCT CTC CCT T | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35305 | 0.40 uM |
| 35306 | 0.40 uM |
| 35307 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.