Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:129626907+129627017 111bp ACGGATAAGTCGGCGAGAG GAATTGAACGGGGGAAGG
Mutant= 116 bp
Wild Type = 111 bp
Wt Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTacttcccggtggttccgtctttcccgctttcctttcccttcccccgttcaattc
Mutant Sequence: acggataagtcggcgagaggggacggtttgcgcttcggtttccggtcctccctcgGTggtgggattcaaagtagttggtagaactgcagaagccccctcatgcctctttctcatca
1047 bp deletion beginning at Chromosome 2 positive strand position 129,801,227 bp TACTTCCCGGTGGTTCCGTC, and ending after AGATGGATGAAGAGTAGTCC at 129,802,273 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35278 | ACG GAT AAG TCG GCG AGA G | Common | A | |||
| 35279 | GAA TTG AAC GGG GGA AGG | Wild type Reverse | A | |||
| 35280 | TGA TGA GAA AGA GGC ATG AGG | Mutant Reverse | A | |||
| 35281 | Fluorophore-1 | CCG GTG GTT CCG TCT TT | Quencher-1 | WT Probe | ||
| 35282 | Fluorophore-2 | CGG TGG TGG GAT TCA AAG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35278 | 0.40 uM |
| 35279 | 0.40 uM |
| 35280 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.