For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:75524241-75524345 105bp AGCACACACACCCATCACAC TCCCTCTGAAGTCTTTCCTGA
Mutant= 136 bp
Wild Type = 105 bp
Sequence
Wt Sequence: agcacacacacccatcacacaagctgcttgagagtcagaggagctgcgcagcttgccagggaatgtctaGTgcccagctggaagtcaggaaagacttcagaggga
Mutant Sequence: gccaggctgacatagtaggatgctatctctaaatagatggatgataaattaattaattaaatgcaatgaaaaagttaagtatttcaaaaagggataggttATgcccagctggaagtcaggaaagacttcagaggga
406 bp deletion beginning at Chromosome 9 negative strand position 75,676,874 bp, TGAAATGATGCGTGGACTAG, and ending after GCTTGCCAGGGAATGTCTAG at 75,676,469 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35270 | Fluorophore-1 | AGG GAT AGG TTA TGC CCA GC | Quencher-1 | MUT Probe | ||
| 35271 | AGC ACA CAC ACC CAT CAC AC | Wild type Forward | A | |||
| 35272 | TCC CTC TGA AGT CTT TCC TGA | Common | A | |||
| 35273 | GCC AGG CTG ACA TAG TAG GA | Mutant Forward | A | |||
| 35274 | Fluorophore-2 | AGG AGC TGC GCA GCT T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35271 | 0.40 uM |
| 35272 | 0.40 uM |
| 35273 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.