For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:4242050+4242209 160bp GAAATGTTGCTGGTCCAAGG TGGATCATTCAAGAGAACTGGA
Mutant= 153 bp
Wild Type = 160 bp
Sequence
Wt Sequence: gaaatgttgctggtccaaggactcctttgaagacccctagttttgagtgggtaccctatgaGTtcagaagcctcctaaagattctcaacctttgaagctaaagatttctgccttttcttctagGGTAGACCCAAGCTCTCCAGTTCTCTTGAATGATCCA
Mutant Sequence: tcaagccaacactatgctttctgtttgtaatttgcaaaacagaattaaactccaaGTtcagaagcctcctaaagattctcaacctttgaagctaaagatttctgccttttcttctagGGTAGACCCAAGCTCTCCAGTTCTCTTGAATGATCC
520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35255 | Fluorophore-1 | CCT TTG AAG ACC CCT AGT TTT G | Quencher-1 | WT Probe | ||
| 35256 | Fluorophore-2 | TGC AAA ACA GAA TTA AAC TCC AAG | Quencher-2 | MUT Probe | ||
| 35257 | GAA ATG TTG CTG GTC CAA GG | Wild type Forward | A | |||
| 35258 | TGG ATC ATT CAA GAG AAC TGG A | Common | A | |||
| 35259 | CAA GCC AAC ACT ATG CTT TCT G | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35257 | 0.40 uM |
| 35258 | 0.40 uM |
| 35259 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.