>chr8:86488607+86488735 129bp CCCTCACAAGCTGATGTCAC TCTCCTGTGGGCCTAACTTG
Mutant= 148 bp
Wild Type = 129 bp
Wt Sequence: ccctcacaagctgatgtcacaggactcaagtcagccTCtactatatggttcctctcggctactgagaggcctaattttcccgggagggccagagtcaaggtcacttggccaagttaggcccacaggaga
Mutant Sequence: ccctcacaagctgatgtcacaggactcaagtcagccTCtgaaagcacactggttttggcagtcaagtttaagttcaaatccttaaacttggactggtgacaaaactactgtaatcccagctacttaggatgtagaagcaggaagacca
526 bp deletion spanning ENSMUSE00001257874 (exon 2) beginning at Chromosome 8 positive strand position 83,964,745 bp CTACTATATGGTTCCTCTCG, and ending after CTAGAACCTTCCTCTTTTAC at 83,965,270 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35236 | Fluorophore-1 | TCG GCT ACT GAG AGG CCT AAT | Quencher-1 | WT Probe | ||
| 35237 | CCC TCA CAA GCT GAT GTC AC | Common | A | |||
| 35238 | TCT CCT GTG GGC CTA ACT TG | Wild type Reverse | A | |||
| 35239 | TGG TCT TCC TGC TTC TAC ATC C | Mutant Reverse | A | |||
| 35240 | Fluorophore-2 | ACA CTG GTT TTG GCA GTC AAG | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35237 | 0.40 uM |
| 35238 | 0.40 uM |
| 35239 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.