For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:113685631-113685724 94bp ACTGGCTGAATGCGCTAGA CGCAAGTAACTCCAAGAATTATGC
Mutant= 100 bp
Wild Type = 94 bp
Sequence
Wt Sequence:
Mutant Sequence:
322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35166 | Fluorophore-1 | AAC AGC TGC TGT GTA CAT TTG C | Quencher-1 | MUT Probe | ||
| 35167 | ACT GGC TGA ATG CGC TAG A | Common | A | |||
| 35168 | ACA CTC AGA GAG GAA ATA ATG TGG | Mutant Reverse | A | |||
| 35169 | CGC AAG TAA CTC CAA GAA TTA TGC | Wild type Reverse | A | |||
| 35170 | Fluorophore-2 | AGG CAG TGT TTT AAT CTT GGT GTC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35167 | 0.40 uM |
| 35168 | 0.40 uM |
| 35169 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.