For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut= 110 bp
Wt= 108 bp
Sequence
Wt Sequence:
Mutant Sequence:
235 bp deletion beginning at Chromosome 2 positive strand position 93,198,127 bp, TTGGGGAAAACATTTATGTT, and ending after GGATGGTTTTGTGTCCCGGG at 93,198,361 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34979 | AGG CAG GAG AGG TTG AGC TT | Common | A | |||
| 34981 | Fluorophore-1 | CTG GGC CTT GCT CTG AAT TA | Quencher-1 | MUT Probe | ||
| 34982 | Fluorophore-2 | CCC AGG TGT CCA CAG GAG | Quencher-2 | WT Probe | ||
| 34983 | AAC AGC CAG GGC TAT TTG AG | Mutant Reverse | A | |||
| 34984 | TCT CAC CCA CCC ACC TTC | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34979 | 0.40 uM |
| 34983 | 0.40 uM |
| 34984 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.