For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut=114 bp
Wt= 114 bp
Sequence
Wt Sequence:
Mutant Sequence:
563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10).In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34974 | TTC CAA CGA CAC ATC CCA AT | Common | A | |||
| 34975 | Fluorophore-1 | AAT GGC CCT GTG TTT TCT CA | Quencher-1 | WT Probe | ||
| 34976 | Fluorophore-2 | TTC TTG AGA TGT ACC CCA GTG | Quencher-2 | MUT Probe | ||
| 34977 | GCA ACA CTA AAG GCA CCC ATA | Mutant Reverse | A | |||
| 34978 | AAG CAC ACG TTT GAC TTG GA | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34974 | 0.40 uM |
| 34977 | 0.40 uM |
| 34978 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.