Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr3:108380912+108381034 123bp TGCCCAGCTATAATTGTGTTTG ACTGCGAGAGAGCAAGAGTG
Mutant= 119 bp
Wild Type = 123 bp
Wt Sequence: tgcccagctataattgtgtttgaaccattgtttctaattgCGtttaatcctagttggtatggaaagtatactggtggcattggtcagtctctgagtcaggcaacactcttgctctctcgcagT
Mutant Sequence: tgcccagctataattgtgtttgaaccattgtttctaattgCTttgtgcaagttcctggtttctatttgccattactctgaatatcacatcaatgtatcccagtgcttcagagcttgttt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34892 | TGC CCA GCT ATA ATT GTG TTT G | Common | A | |||
| 34893 | ACT GCG AGA GAG CAA GAG TG | Wild type Reverse | A | |||
| 34894 | AAA CAA GCT CTG AAG CAC TGG | Mutant Reverse | A | |||
| 34895 | Fluorophore-1 | TGG TGG CAT TGG TCA GTC T | Quencher-1 | WT Probe | ||
| 34896 | Fluorophore-2 | TTG CCA TTA CTC TGA ATA TCA CAT C | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34892 | 0.40 uM |
| 34893 | 0.40 uM |
| 34894 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.