Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr6:43510188-43510279 92bp GGGAAAAAGGTAGAATGTAGAGCA ACCACTCACAGACCCTTTGC
Mutant= 127 bp
Wild Type = 92 bp
Wt Sequence: gggaaaaaggtagaatgtagagcaggtagctccatatcttctccaccTCtgttcagatggactggagaagatgcaaagggtctgtgagtggt
Mutant Sequence: gggaaaaaggtagaatgtagagcaggtagctccatatcttctccaccTGggctgtataaccatgatgcattacttctttctatgaatgagatctcttagaattaggatcatgttttgtcttgttttt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34887 | Fluorophore-1 | TGG GCT GTA TAA CCA TGA TGC | Quencher-1 | |||
| 34888 | GGG AAA AAG GTA GAA TGT AGA GCA | Common | A | |||
| 34889 | ACC ACT CAC AGA CCC TTT GC | Wild type Reverse | A | |||
| 34890 | AAA AAC AAG ACA AAA CAT GAT CC | Mutant Reverse | A | |||
| 34891 | Fluorophore-2 | CTG TTC AGA TGG ACT GGA GAA GA | Quencher-2 |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34888 | 0.40 uM |
| 34889 | 0.40 uM |
| 34890 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.