Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr5:136244769-136244859 91bp TTACTCACCTGCCCACCAGT TCGTTTTGATCGGACATCTG
Mutant= 90 bp
Wild Type = 91 bp
Wt Sequence: ttactcacctgcccaccagtgttctcatgtcccttcACgtgtccagttctgagttcaacccttttgttccccagATGTCCGATCAAAACGA
Mutant Sequence: ttactcacctgcccaccagtgttctcatgtcccttcATgcatctgctctctgcgtcctccgggatgcctgtgagcttggtgctgtgtcta
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34882 | TTA CTC ACC TGC CCA CCA GT | Common | A | |||
| 34883 | TCG TTT TGA TCG GAC ATC TG | Wild type Reverse | A | |||
| 34884 | TAG ACA CAG CAC CAA GCT CA | Mutant Reverse | A | |||
| 34885 | Fluorophore-1 | TGT CCA GTT CTG AGT TCA ACC C | Quencher-1 | WT Probe | ||
| 34886 | Fluorophore-2 | TGC GTC CTC CGG GAT | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34882 | 0.40 uM |
| 34883 | 0.40 uM |
| 34884 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.