Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr8:74692133+74692229 97bp GACAGGAGCAGCAGAAAGGT TTCCCTGCTAGAAGCACAGC
Mutant= 111 bp
Wild Type = 97 bp
Wt Sequence: gacaggagcagcagaaaggtggagcgcatctcccattcccagcttcCCttcagctactgttgtcgccacagccttaggctgtgcttctagcagggaa
Mutant Sequence: gacaggagcagcagaaaggtggagcgcatctcccattcccagcttcCCtgaatcgtggcccttcgctggactctacactgggagcagagctgttggtgcccttccacatat
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34815 | GAC AGG AGC AGC AGA AAG GT | Common | A | |||
| 34816 | TTC CCT GCT AGA AGC ACA GC | Wild type Reverse | A | |||
| 34817 | ATA TGT GGA AGG GCA CCA AC | Mutant Reverse | A | |||
| 34818 | Fluorophore-1 | AGC TAC TGT TGT CGC CAC AG | Quencher-1 | WT Probe | ||
| 34819 | Fluorophore-2 | CCC TTC GCT GGA CTC TAC AC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34815 | 0.40 uM |
| 34816 | 0.40 uM |
| 34817 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.