Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr2:156921239+156921333 95bp CACACTCAACCAGCCCATC ACTCTGGGACTTCCCCATCT
Mutant= 92 bp
Wild Type = 95 bp
Wt Sequence: cacactcaaccagcccatccccatcacacgcttagtgacatcttagtgtgacgtgactgggaacgaGGagtcacaagatggggaagtcccagagt
Mutant Sequence: ttgaaagcaggaagctttggaggtttgattgttagcatttatttggcactgccaggatgcaggGGagtcacaagatggggaagtcccagagt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34543 | CAC ACT CAA CCA GCC CAT C | Wild type Forward | A | |||
| 34544 | ACT CTG GGA CTT CCC CAT CT | Common | A | |||
| 34545 | TTG AAA GCA GGA AGC TTT GG | Mutant Forward | A | |||
| 34546 | Fluorophore-1 | CAC ACG CTT AGT GAC ATC TTA GTG | Quencher-1 | |||
| 34547 | Fluorophore-2 | TGG CAC TGC CAG GAT GC | Quencher-2 |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34543 | 0.40 uM |
| 34544 | 0.40 uM |
| 34545 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.