Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr13:99458128-99458219 92bp AGGCTTGGGTGTATCTGGTG CTCGTCACTCAGCCTCCAGT
Mutant= 90 bp
Wild Type = 92 bp
Wt Sequence: ggcttgggtgtatctggtggcatgtttgagatcccgcctcgCTgctcacactcagccgggaaaccttgggcactggaggctgagtgacgag
Mutant Sequence: ccaacccagcctgttttacttgacatggaacaggtccacttctccatccccgcgCTgctcacactcagccgggaaaccttgggcactggaggctgagtgacgag
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34538 | AGG CTT GGG TGT ATC TGG TG | Wild type Forward | A | |||
| 34539 | CTC GTC ACT CAG CCT CCA GT | Common | A | |||
| 34540 | CCA ACC CAG CCT GTT TTA CT | Mutant Forward | A | |||
| 34541 | Fluorophore-1 | CAT GTT TGA GAT CCC GCC | Quencher-1 | WT Probe | ||
| 34542 | Fluorophore-2 | CAT GGA ACA GGT CCA CTT CTC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34538 | 0.40 uM |
| 34539 | 0.40 uM |
| 34540 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.