For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:10591938-10592027 90bp AGATTTATTGGCTTTCCGTTCC CACCACATAAGGTGCTAGATGC
Mutant= 113 bp
Wild Type = 90 bp
gel was done on req 466215, no need to gel moving forward 4-13-18 ESP
Sequence
Wt Sequence: agatttattggctttccgttccttgactataaagggaccaaaatCCgcaggactaagtgagatctaatgcatctagcaccttatgtggtg
Mutant Sequence: agatttattggctttccgttccttgactataaagggaccaaaatCTaaagtcatatcttcccaagtgtgttcttcctcttcttgtaaactgggactttctgtataagcctggc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34471 | Fluorophore-1 | CAT ATC TTC CCA AGT GTG TTC TTC | Quencher-1 | MUT Probe | ||
| 34472 | Fluorophore-2 | ATC CGC AGG ACT AAG TGA GAT C | Quencher-2 | WT Probe | ||
| 34473 | AGA TTT ATT GGC TTT CCG TTC C | Common | A | |||
| 34474 | CAC CAC ATA AGG TGC TAG ATG C | Wild type Reverse | A | |||
| 34475 | GCC AGG CTT ATA CAG AAA GTC C | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34473 | 0.40 uM |
| 34474 | 0.40 uM |
| 34475 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.