For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut= 118 bp
Wt= 104 bp
321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34165 | AGA AGA CAC GGG CAC AAA AC | Common | A | |||
| 34166 | CTT ATC CCT GTA AAG GCC CAT C | Wild type Reverse | A | |||
| 34167 | CAG GCA TGT GAC CAA AAG G | Mutant Reverse | A | |||
| 34168 | Fluorophore-1 | CCT TGC TGG TCA GTG TCC TA | Quencher-1 | WT Probe | ||
| 34169 | Fluorophore-2 | CAG GGC AGG ACT GTT AGG AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34165 | 0.40 uM |
| 34166 | 0.40 uM |
| 34167 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.