Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr7:52451576-52451673 98bp AACTCAGGAGAGGGACTTGC AGGCCACGGTTTAAGAACAG
Mutant= 96 bp
Wild Type = 98 bp
Wt Sequence: aactcaggagagggacttgccccaggtggctctgcatgctgtagggcaggcgtgtcatCAacctgctgatgacagacactgttcttaaaccgtggcct
Mutant Sequence: aactcaggagagggacttgccccaggtggctctgcatgctgtagggcaggcgtgtcatCTgagaaccagctgccttgggtgatggtgcaggggtcc
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33945 | AAC TCA GGA GAG GGA CTT GC | Common | A | |||
| 33946 | GGA CCC CTG CAC CAT CAC | Mutant Reverse | A | |||
| 33947 | AGG CCA CGG TTT AAG AAC AG | Wild type Reverse | A | |||
| 33948 | Fluorophore-1 | CTG AGA ACC AGC TGC CTT G | Quencher-1 | MUT Probe | ||
| 33949 | Fluorophore-2 | TCA TCA ACC TGC TGA TGA CAG | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33945 | 0.40 uM |
| 33946 | 0.40 uM |
| 33947 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.