Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr9:56321958+56322068 111bp TGCTCGTTAAGAAATGGCTCT TGCTACCTTCCATGTGTTTCC
Mutant= 115 bp
Wild Type = 111 bp
Wt Sequence: tgctcgttaagaaatggctcttatatgatgagtcaaagacctggacaaccccattcaTCtggtccattactagggtttccacatcacatgggaaacacatggaaggtagca
Mutant Sequence: tgctcgttaagaaatggctcttatatgatgagtcaaagacctggacaaccccattcaTCaggtaactcaagctgctagaattgcagatgtgctcaccatgctcagtcgtgacaaa
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33931 | TGC TCG TTA AGA AAT GGC TCT | Common | A | |||
| 33932 | TTT GTC ACG ACT GAG CAT GG | Mutant Reverse | A | |||
| 33933 | TGC TAC CTT CCA TGT GTT TCC | Wild type Reverse | A | |||
| 33934 | Fluorophore-1 | CTG GTC CAT TAC TAG GGT TTC C | Quencher-1 | |||
| 33935 | Fluorophore-2 | CTC AAG CTG CTA GAA TTG CAG | Quencher-2 |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33931 | 0.40 uM |
| 33932 | 0.40 uM |
| 33933 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.