Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr13:32816974-32817057 84bp TCCAGCCCCAGAAATATGAC CACAAACTCTTTGGGGTCAC
Mutant= 84 bp
Wild Type = 91 bp
Wt Sequence: tccagccccagaaatatgactgccttGGaacttcagatttctcgctgttttgcattgtctaaatgtgaccccaaagagtttgtg
Mutant Sequence: tccagccccagaaatatgactgccttGGctttatttgccatgtcataaagtctgagagtaggaaaaacccagtgtgactcgccaaaaggtc
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33917 | TCC AGC CCC AGA AAT ATG AC | Common | A | |||
| 33918 | CAC AAA CTC TTT GGG GTC AC | Wild type Reverse | A | |||
| 33919 | GAC CTT TTG GCG AGT CAC AC | Mutant Reverse | A | |||
| 33920 | Fluorophore-1 | CCT TGG AAC TTC AGA TTT CTC G | Quencher-1 | WT Probe | ||
| 33922 | Fluorophore-2 | CCA TGT CAT AAA GTC TGA GAG TAG G | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33917 | 0.40 uM |
| 33918 | 0.40 uM |
| 33919 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.