Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr10:86267747+86267837 91bp CCCCTTTGGTGTCTGAAGAG ACCCTGCAGCCACTCACTAC
Mutant= 108 bp
Wild Type = 91 bp
Wt Sequence: cccctttggtgtctgaagagtagacagccctgcgcattcatgcccagaccctgcCCttgtacagaaactctgtagtgagtggctgcagggt
Mutant Sequence: tgtaccactgagctgcatccccagacttggatctgcccgttctgaacattatatggatgtgcaaactgctcCCttgtacagaaactctgtagtgagtggctgcagggt
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33912 | CCC CTT TGG TGT CTG AAG AG | Wild type Forward | A | |||
| 33913 | ACC CTG CAG CCA CTC ACT AC | Common | A | |||
| 33914 | TGT ACC ACT GAG CTG CAT CC | Mutant Forward | A | |||
| 33915 | Fluorophore-1 | TTG GAT CTG CCC GTT CTG | Quencher-1 | MUT Probe | ||
| 33916 | Fluorophore-2 | CGC ATT CAT GCC CAG AC | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33912 | 0.40 uM |
| 33913 | 0.40 uM |
| 33914 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.