For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:88402130+88402304 175bp CTTGGCGCTAGCATACAGG CCACACTTAAAAGAGTTGATGGT
Mutant= 160 bp
Wild Type = 175 bp
Sequence
Wt Sequence: CTTGGCGCTAGCATACAGgtgggctgccgtctgttctcctgctaactccacgtggacgAGttttatagaattagtgctttaaaagaacactacaaagtatattttggagatcatttgatatatttgagtatagactgtatattacataacataccatcaactcttttaagtgtgg
Mutant Sequence: ggaggctttcttcgcatgtataaagacaactttgtgcagtatgGGttttatagaattagtgctttaaaagaacactacaaagtatattttggagatcatttgatatatttgagtatagactgtatattacataacataccatcaactcttttaagtgtgg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33950 | Fluorophore-1 | AGA CAA CTT TGT GCA GTA TGG GT | Quencher-1 | MUT Probe | ||
| 33951 | Fluorophore-2 | TGC CGT CTG TTC TCC TGC | Quencher-2 | WT Probe | ||
| 33952 | CTT GGC GCT AGC ATA CAG G | Wild type Forward | A | |||
| 33953 | CCA CAC TTA AAA GAG TTG ATG GT | Common | A | |||
| 33954 | GGA GGC TTT CTT CGC ATG T | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33952 | 0.40 uM |
| 33953 | 0.40 uM |
| 33954 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.