Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
>chr17:46382899-46383008 110bp ACGCTTTTCTCAAAGCCATC ACTAAAGGCGTGTGGCTCAG
Mutant= 97 bp
Wild Type = 110 bp
Wt Sequence: acgcttttctcaaagccatcccTCtggggcaggtagggtggttcacacctatgacagtctgggctacatagtaaacattgtatcaagaatctgagccacacgcctttagt
Mutant Sequence: acgcttttctcaaagccatcccTCtgggagaacagctgtccccaccccacctctagtctcactgtgtacaccctcggaacacagcgctagcagcact
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 33901 | ACG CTT TTC TCA AAG CCA TC | Common | A | |||
| 33902 | ACT AAA GGC GTG TGG CTC AG | Wild type Reverse | A | |||
| 33903 | AGT GCT GCT AGC GCT GTG T | Mutant Reverse | A | |||
| 33906 | Fluorophore-1 | CAC ACC TAT GAC AGT CTG GGC | Quencher-1 | WT Probe | ||
| 33907 | Fluorophore-2 | CCC CAC CTC TAG TCT CAC TGT G | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 33901 | 0.40 uM |
| 33902 | 0.40 uM |
| 33903 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.